gabT [2018-04-24 15:55:30]

gamma-aminobutyrate transaminase, general stress protein

locus: BSU03900

pI: 5.30

mw: 47.09 kDa

protein length: 436 aa

gene length: 1308 bp

function: utilization of gamma-amino butyric acid

product: gamma-aminobutyrate transaminase

essential: no

ec: 2.6.1.19

synonyms: ycnG

Genomic Context

categories

• [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.10|Utilization of gamma-amino butyric acid]

Gene

Coordinates: 441,571 → 442,881

Phenotypes of a mutant

• growth defect in the presence of gamma-aminobutyrate [Pubmed|24127574]
• no growth with gamma-aminobutyrate as single carbon source [Pubmed|24529384]

The protein

Catalyzed reaction/ biological activity

• 4-aminobutanoate + 2-oxoglutarate = succinate semialdehyde + L-glutamate (according to Swiss-Prot)
• the protein was reported to be involved in norspermidine production and biofilm disassembly [Pubmed|22541437]; however, this is not the case [Pubmed|24529384]and the original paper has been [http://www.cell.com/cell/fulltext/S0092-8674(15)00495-X retracted]

Protein family

• class-III pyridoxal-phosphate-dependent aminotransferase family (according to Swiss-Prot)

Expression and Regulation

Operons

• genes: [gene|4E1FD02C6FE4103E3B4942BF5221C062CB8D0B9B|gabT]-[gene|A0BEB92D54799956A4ADE106A1388E5710141069|gabD]
  description: [Pubmed|12123465]

  sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12123465], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]

  regulatory mechanism

  • [protein|C7C36FAC0CE72226960FC7E8E016B8EC77AF1036|GabR]: activation, [Pubmed|32147931,12123465], in [regulon|C7C36FAC0CE72226960FC7E8E016B8EC77AF1036|GabR regulon]

  regulation

  • ''[protein|A0BEB92D54799956A4ADE106A1388E5710141069|GabD]'': induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [Pubmed|15805528]

Biological materials

Mutant

• MGNA-C068 (ycnG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2066 NBRP B. subtilis, Japan]
• BKE03900 (Δ[gene|4E1FD02C6FE4103E3B4942BF5221C062CB8D0B9B|gabT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGAATATCCCCCTGTC, downstream forward: _UP4_TAATCATTGGAAAGAAAATG
• BKK03900 (Δ[gene|4E1FD02C6FE4103E3B4942BF5221C062CB8D0B9B|gabT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGAATATCCCCCTGTC, downstream forward: _UP4_TAATCATTGGAAAGAAAATG

Labs working on this gene/protein

• [SW|Linc Sonenshein], Tufts University, Boston, MA, USA [http://www.tufts.edu/sackler/microbiology/faculty/sonenshein/index.html Homepage]

References

• 15223311,12123465,22541437,24529384,4590473,26681693